Prepare for the upcoming exams with a variety of sample papers & previous year question papers.

  • By proceeding ahead you expressly agree to the CollegeDekho terms of use and privacy policy
  • Why register with us?

    Stay up-to date with Exam Notification and NewsGet Exam Date AlertsGet free Sample Papers & Mock TestYou won’t get unwanted calls from third parties
We are glad that you have successfully downloaded the document you needed. We hope that the information provided will be helpful and informative.
Error! Please Check Inputs

Get direct link to download answer key

  • By proceeding ahead you expressly agree to the CollegeDekho terms of use and privacy policy
  • Why register with us?

    Stay up-to date with Exam Notification and NewsGet Exam Date AlertsGet free Sample Papers & Mock TestYou won’t get unwanted calls from third parties
We are glad that you have successfully downloaded the document you needed. We hope that the information provided will be helpful and informative.
Error! Please Check Inputs

NEET R3 Unofficial Answer Key 2024 (Available)

Appeared for NEET Set Code R3 paper? Download NEET R3 Unofficial Answer Key 2024 in PDF format here to evaluate your performance in the test.

Predict your Rank

Get direct link to download answer key

  • By proceeding ahead you expressly agree to the CollegeDekho terms of use and privacy policy
  • Why register with us?

    Stay up-to date with Exam Notification and NewsGet Exam Date AlertsGet free Sample Papers & Mock TestYou won’t get unwanted calls from third parties
We are glad that you have successfully downloaded the document you needed. We hope that the information provided will be helpful and informative.
Error! Please Check Inputs

NEET R3 Unofficial Answer Key 2024: The National Testing Agency (NTA) conducted the NEET exam today, May 5, 2024. Since the examination has concluded, candidates who have appeared for the exam can check out the answers for all 200 questions here. The NEET R3 Answer key 2024 (unofficial) has been prepared with the help of subject matter experts. The key for all the subjects has been added below. Candidates can click the link in the 'Table of Contents' to get directed to the subject-wise answer key. 

Also Read |

Table of Contents |

NEET R3 Unofficial Answer Key 2024 for Zoology

Here is the unofficial NEET 2024 answer key for Set Code R3 Zoology subject:

R3 Zoology Section A

Question NumberSet R3 Correct AnswerQuestion NumberSet R3 Correct Answer
151(3)169(3)
152(2)170(3)
153(2)171(2)
154(1)172(1)
155(2)173(3)
156(3)174(4)
157(1) 175(1) A only
158(1)176(3) A-IV, B-II, C-I, D-II
159(3)177(2) A-IV, B-I, C-II, D-III
160(2)178(1) A-III, B-IV, C-II, D-I
161(3)179(3) Gene 'X' is responsible for recognition sites and 'Y' is responsible for antibiotic resistance.
162(3)180(3) Statement I is false but Statement II is true
163(1)181
(4) Both A and R are correct, and R is the correct explanation of A
164(3)182(4) E-C-A-D-B
165(4)183(2) 5'AUGUAAAGUUUAUAGGUAAGU3
166(1)184(1) A-III, B-1, C-II, D-IV
167(2)185(2) Tumor inducing plasmid
168(2)------

R3 Zoology Section B

Question NumberCorrect AnswerQuestion NumberCorrect Answer
186(1) A-III, B-II, C-IV, D-I194(4) E, A, D, C, and B
187(4) Both Statements I and II are true.195(2) B, D, and E only
188(4) Both Statement 1 and Statement Il are correct.196(4) A-IV, B-II, C-III, D-I
1892) Loop of Henle of juxta medullary nephron runs deep into medulla197(2) Statement 1 is correct but Statement II is incorrect
190(3) A-III, B-IV, C-I, and D-II198(4) A-II, B-I, C-III, D-IV
191(2) A-III, B-IV, C-I, and D-II199(4) A only
192(3) A-IV, B-III, C-I, and D-II200(4) Both Statement I and Statement II are correct
193(4) FSH, Leydick cells, Sertoli cells, spermiogenesis------

Expected Cutoff |

NEET R3 Unofficial Answer Key 2024 for Chemistry

Here is the unofficial NEET 2024 answer key for Set Code R3 Chemistry subject:

R3 Chemistry Section A

QAQA
51(3)69(1)
52(2)70(2)
53(4)71(4)
54(4)72(4)
55(3)73(2)
56(2)74(4)
57(4)75(3)
58(2)76(2)
59(4)77(4)
60(3)78(3)
61(3)79(3)
62(1)80(1)
63(1)81(1)
64(2)82(4)
65(4)83(3)
66(4)84(3)
67(3)85(1)
68(1)------

R3 Chemistry Section B

Question NumberSet R3 Correct AnswerQuestion NumberSet R3 Correct Answer
86(3)94(2) E, C, D, B, A
87(1)95(1) -413.14 calories
88(3)96(2)
89(4)97(1) 380.4 kJ/mol
90(2) butanamide98(3) dilute sulphuric acid
91(1) Ce3+ and Eu2-99(4) 37°C
92(4)100(4) Three resonance structures can be drawn for ozone.
93(4) ABC3------

Upcoming Events of NEET 2024

NEET R3 Unofficial Answer Key 2024 for Physics

The unofficial NEET 2024 answer key for Set Code R3 Physics subject has been provided here:

R3 Physics Section A

Question NumberSet R3 Correct AnswerQuestion NumberSet R3 Correct Answer
1(4)19(2) 1:1
2(2)20(2) 1.98 mN
3(3)21(4) 4 mm
4(4)22(3) 3.92 ms-2
5(4)23(3) 10 (N + 1)
6(3)24(4) Both Statements I and II are correct
7(3)25(2) 6 N
8(3)26(4) Strain and Angle
9(2)27(4) 8.5 cm
10(4)28(4) A is correct but B is incorrect
11(1)29(3) 60 ohms
12(2)30(1) 5 m, 2s
13(2)31(4) A and B only
14(3)32(1) A-III, B-IV, C-II, D-1
15(3)33(2) 2
16(1)34(4) 5
17(1) Point P moves faster than Point A35(1) 4T
18(4) Zero------

R3 Physics Section B

Question NumberSet R3 Correct AnswerQuestion NumberSet R3 Correct Answer
36(3) 2 * 103 N44(2) A, C, and D only
37(4)45(2)
38(1) 2846(1) Displacement current of magnitude equal to I flows in the same direction as I.
39(3)47(1)
40(1) 0.93 A48(1)
41(1) 2:949(3)
42(2) 50(4)
43(3) they originate with charges moving with uniform speed.------

NEET R3 Unofficial Answer Key 2024 for Botany

The following table displays NEET 2024 answer key for Set Code R3 Botany subject:

R3 Botany Section A

Question NumberSet R3 Correct AnswerQuestion NumberSet R3 Correct Answer
101(3) Promotor, Structural Gene, Terminator119(4)
102(1) A, B, C, and D only120(2)
103(1) Phospholipids121(4) In situ conservation
104(3) A, B, and D only122(2) A-III, B-IV, C-I, D-II
105(2)123(2) Dedifferentiation
106(4)124(2) Anaphase
107(2)125(1) bb
108(3)126(1) Red-flowered as well as pink-flowered plants
109(3)127(2) Competitive Inhibition
110(2)128(4) Both Statement I and Statement II are true
111(4)129(4) C
112(1)130(1) A, C, D, and E only
113(4)131(3) D
114(4)132(4) Promotes apical dominance
115(3)133(4) Both Statement I and Statement II are true
116(4)134(4) Totipotency
117(2)135(3) Statement I is false but Statement II is true
118(1)------

R3 Botany Section B

Question NumberSet R3 Correct AnswerQuestion NumberSet R3 Correct Answer
136(1) Gibberellin144(2) 10x (kcal m²) yr-1
137(4) Both Statement I and Statement II are true145(2) A-IV, B-III, C-II, D-I
138(1) A-IV, B-I, C-II, D-III146(2) A-I, B-II, C-IV, D-III
139(2) A, C, D, and E only147(2)
140(3) The DNA dependent DNA polymerase catalyses polymerization in 5'→3' direction.148(1)
141(4) Malic acid → Oxaloacetic acid149(1)
142(3) A-III, B-IV, C-II, D-I150(1)
143(4) Wind pollinated plant inflorescence showing flowers with well exposed stamens.  ------

NEET Set-Wise Answer Key 2024

NEET Expected Rank Analysis 2024

NEET Expected Percentile Analysis 2024

Keep visiting CollegeDekho for the latest Education News on entrance exams, board exams and admissions. You can also write to us at our email ID news@collegedekho.com.

Get Help From Our Expert Counsellors

Get Counselling from experts, free of cost!

  • By proceeding ahead you expressly agree to the CollegeDekho terms of use and privacy policy
  • Why register with us?

    Stay up-to date with Exam Notification and NewsGet Exam Date AlertsGet free Sample Papers & Mock TestYou won’t get unwanted calls from third parties
Thank you! Our counsellor will soon be in touch with you to guide you through your admissions journey!
Error! Please Check Inputs

NEET Previous Year Question Paper

NEET 2016 Question paper

Previous Year Question Paper

  • By proceeding ahead you expressly agree to the CollegeDekho terms of use and privacy policy
  • Why register with us?

    Stay up-to date with Exam Notification and NewsGet Exam Date AlertsGet free Sample Papers & Mock TestYou won’t get unwanted calls from third parties
Thank You! We shall keep you posted on the latest updates!
Error! Please Check Inputs

Be the First to Know

Get Access to Latest Updates

Stay updated on important announcements on dates, events and notification

  • By proceeding ahead you expressly agree to the CollegeDekho terms of use and privacy policy
  • Why register with us?

    Stay up-to date with Exam Notification and NewsGet Exam Date AlertsGet free Sample Papers & Mock TestYou won’t get unwanted calls from third parties
Thank You! We shall keep you posted on the latest updates!
Error! Please Check Inputs

Do you have a question? Ask us.

  • Typical response between 24-48 hours

  • Get personalized response

  • Free of Cost

  • Access to community

Recent News

Talk To Us

  • By proceeding ahead you expressly agree to the CollegeDekho terms of use and privacy policy
  • Why register with us?

    Stay up-to date with Exam Notification and NewsGet Exam Date AlertsGet free Sample Papers & Mock TestYou won’t get unwanted calls from third parties
We are glad that you have successfully downloaded the document you needed. We hope that the information provided will be helpful and informative.
Error! Please Check Inputs