NEET Q3 Unofficial Answer Key 2024 (Available)

Aman Agarwal

Updated On: May 06, 2024 04:01 PM

Check the NEET Q3 Unofficial Answer Key 2024 PDF prepared with the help of subject matter experts. Candidates can cross-check their answers to calculate their raw score.
NEET Q3 Unofficial Answer Key 2024NEET Q3 Unofficial Answer Key 2024

NEET Q3 Unofficial Answer Key 2024: Candidates who appeared for the NEET 2024 exam on May 5 can check the key for Set Q3. The answers have been added for all the 200 questions asked in the exam. NEET Q3 answer key 2024 (unofficial) has been prepared by the subject matter experts. Candidates can expect the official answer key to be released by 12 - 15 days after the completion of the exam. Until then candidates can make use of the NEET Q3 answer key 2024 (unofficial) to determine the marks obtained in the exam.

Also Read |

Links |
NEET Answer Key 2024 Unofficial (All Sets) NEET Question Paper 2024 NEET 2024 Exam Analysis
NEET Expected Rank 2024 NEET Expected Percentile Score 2024 NEET Expected Cutoff Score 2024

Table of Contents |

NEET Q3 Unofficial Answer Key 2024 for Physics

Here is the unofficial NEET 2024 answer key for Set Code Q3 Physics subject:

Q3 Physics Section A

Question Number Set Q3 Correct Answer Question Number Set Q3 Correct Answer
1 2 19 1- (10)
2 3- There will be a central dark fringe surrounded by a few colored fringes 20 2
3 3- B 21 1- 2µF
4 3- 8V 22 1- Strain and angle
5 4- 1240π 2 23 1- 4mm
6 2- 52Ω 24 1- AB and DC
7 3- 6N 25 4- 3.92ms -2
8 4- 4.4mT 26 2- A-III, B-IV, C-II, D-I
9 2- 2:1 27 4- The reflected light will be completely polarised but the refracted light will be partially polarised
10 4- Linear Graph 28 1- A-II, B-III, C-IV, D-I
11 2- Both I and II are correct statements 29 2- 2:1
12 2- 4T 30 4- 286, 81
13 3- Both A and B are correct 31 2- 5m, 2s
14 1- Zero 32 1- 19.8mN
15 4- Zero 33 4- AND gate
16 1- 8.5 cm 34 3- A is true but R is false
17 4- Varying velocity and varying acceleration 35 2- Point P moves faster than point Q
18 2- A, B, C and D only --- ---

Q3 Physics Section B

Question Number Set Q3 Correct Answer Question Number Set Q3 Correct Answer
36 2- Displacement current of magnitude equal to I flows in the same direction as I 44 1 (5GmM/6R)
37 4- They originate from charges moving with uniform speed 45 2- A and C only
38 2- 28 46 2 - 0.93 A
39 2- 2:9 47 2- 50 × 10 3 N
40 4- P1 > P2 > P3 48 2 (M/2)
41 3 49 2- A, C and E only
42 1 50 2
43 2- (√2) --- ---

Expected Cutoff |

Links |
NEET General Category Expected Cutoff 2024 NEET EWS Category Expected Cutoff 2024
NEET OBC Category Expected Cutoff 2024 NEET SC Category Expected Cutoff 2024

NEET Q3 Unofficial Answer Key 2024 for Chemistry

Here is the unofficial NEET 2024 answer key for Set Code Q3 Chemistry subject:

Q3 Chemistry Section A

Question Number Set Q3 Correct Answer Question Number Set Q3 Correct Answer
51 3- (A-III, B-IV, C-II, D-I) 69 3- A, C and D only
52 2- B>C>A 70 4
53 1- Both Statements I and II are correct 71 2 (A-III, B-IV, C-I, D-II)
54 1 72 1 (B and D only)
55 1- Both Statements I and II are correct 73 1 (4 mol of helium)
56 4 74 4 (Po)
57 4 75 3- d 4 to d 5 configuration
58 To be updated 76 3- B and E
59 2 (Li<B<Be<C< N) 77 2
60 4 78 1
61 4- Rate constant at two different temperatures 79 3- 2,3-dimethylbutane
62 1- Both Statements I and II are correct 80 1- aqueous copper sulphate
63 1 (Si<C<N<O<F) 81 4- (A-II, B-III, C-IV, D-I)
64 1 (A-II, B-IV, C-I, D-III) 82 1 (Both Statement I and Statement II are true)
65 1 (A-II, B-III, C-IV, D-I) 83 2- (Sublimation)
66 1 (A-I, B-IV, C-II, D-III) 84 3- A-IV, B-I, C-II, D-III
67 4 85 3- Reaction has a tendency to go in backward direction
68 1- (-x) --- ---

Q3 Chemistry Section B

Question Number Set A3 Correct Answer Question Number Set A3 Correct Answer
86 1 94 1- 37°C
87 1- Both Statement I and Statement II are true 95 4- Three canonical forms can be drawn for CO 2 3 ion
88 2-  0.315 g 96 1- propylamine
89 2 97 1- B, A, D, C, E
90 4- H 3 PO 3 and POCl 3 98 2- (–413.14 calories)
91 1- 38.04 kJ/mol 99 4-- (0.717)
92 4- dilute sulphuric acid 100 2- ABC 3
93 1 --- ---

Upcoming Events of NEET 2024

NEET Q3 Unofficial Answer Key 2024 for Botany

Here is the unofficial NEET 2024 answer key for Set Code Q3 Botany subject:

Q3 Botany Section A

Question Number Set Q3 Correct Answer Question Number Set Q3 Correct Answer
101 2- Phospholipids 119 2- Mode of Nutrition
102 4- 3 molecules of ATP and 2 molecules of NADPH 120 4 (a- Perigynous; b- Perigynous)
103 2- 6 bp 121 4- IUCN
104 1- C 122 3- B and C only
105 1- Zinc 123 3- A, C, D, and E only
106 1- Totipotency 124 3- Competitive inhibition
107 1 (A- III, B-II, C-IV, D-I) 125 3- Dedifferentiation
108 3- Statement I is true but statement II is false 126 2- Metaphase
109 1- Datura 127 1- A, C, D and E only
110 2- Biodiversity Conservation 128 1- Both Statement I and II are correct
111 4- B, C, D and E only 129 1- A-III, B-II, C-IV, D-I
112 3- Permease 130 1- Inward curling of leaves in monocots.
113 3- A-III, B-I, C-IV, D-II 131 2- Red flowered as well as pink flowered plants
114 3- Carrying Capacity 132 4- Promotor, Structural gene, Terminator
115 3- Does not affect mature monocotyledonous plants 133 2- bb
116 3- C 134 3- C, D and E only
117 4 - Statement I is false but Statement II is true 135 3- A-III, B-IV, C-I, D-II
118 4- A, B and D only --- ---

Q3 Botany Section B

Question Number Set Q3 Correct Answer Question Number Set Q3 Correct Answer
136 Circular, double stranded 144 1- A-IV, B-I, C-II, D-III
137 2- A-III, B-I, C-IV, D-II 145 3- Succinyl-CoA → Succinic acid
138 1- A-II, B-IV, C-I, D-III 146 3- Statement I is true but Statement II is false
139 4- The DNA dependent DNA polymerase catalyses polymerization in 5’ → 3’ direction 147 1- A-IV, B-II, C-I, D-III
140 1- Wind pollinated plant inflorescence showing flowers with well exposed stamens 148 2- A-III, B-IV, C-I, D-II
141 2- A-I, B-II, C-III, D-IV 149 3-Protoplasts
142 3- A, C, D and E only 150 2- Gibberellin
143 3 --- ---

NEET Q3 Unofficial Answer Key 2024 for Zoology

Here is the unofficial NEET 2024 answer key for Set Code A3 Zoology subject:

Q3 Zoology Section A

Question Number Set Q3 Correct Answer Question Number Set Q3 Correct Answer
151 1- (E-C-A-D-B) 169 1- 5’AUGUACCGUUUAUAGGUAAGU3’
152 2- 10th Segment 170 2- (A-III, B-IV, C-II, D-I)
153 3- Convergent Evolution 171 3- (A-II, B-IV, C-I, D-III)
154 1- Uterine Fundus 172 4- Vaults
155 4 - (A-D-C-B) 173 2
156 4- Glucagon 174 3- Bio-reactors are used to produce small scale bacterial cultures
157 3 -(A-III, B-IV, C-I, D-II) 175 1- Both A and R are correct and R is the correct explanation of A
158 4 (E-C-A-D-B) 176 2- High pO 2 and Lesser H + concentration
159 4- Constant gene pool 177 3- A-III, B-I, C-II, D-IV
160 2- A, B & E only 178 2- A only
161 2 (A-IV, B-III, C-I, D-II) 179 4- A-III, B-I, C-IV, D-II
162 1 (A-II, B-IV, C-I, D-III) 180 2- Both Statement I and Statement II are false
163 3- A-III, B-IV, C-I, D-II 181 2- The gene ‘X’ is responsible for controlling the copy number of the linked DNA and ‘Y’ for protein involved in the replication of Plasmid
164 4- A is false but R is false 182 4- A-II, B-I, C-IV, D-III
165 2- (A-II, B-I, C-IV, D-III) 183 2- A-III, B-I, C-II, D-IV
166 3- A-II, B-IV, C-I, D-III 184 4-A-III, B-I, C-IV, D-II
167 3- Tumor inducing plasmid 185 3- Statement I is true but Statement II is false
168 4- (A-III, B-IV, C-I, D-II) --- ---

Q3 Zoology Section B

Question Number Correct Answer Question Number Correct Answer
186 4- Statement I is false but Statement II is true 194 4- A-III, B-I, C-IV, D-II
187 1- A-IV, B-II, C-III, D-I 195 3- A-III, B-IV, C-I, D-II
188 3- B, D & E only 196 4- A-IV, B-III, C-I, D-II
189 3- Loop of Henle of juxta medullary nephron runs deep into medulla 197 1- A only
190 3- Statement I is correct but Statement II is incorrect 198 2- A-III, B-II, C-IV, D-I
191 1- Both Statement I and Statement II are correct 199 3- Statement I is correct but Statement Il is incorrect
192 1- E, A, D, C, B 200 4- A-III, B-IV, C-I, D-II
193 1- FSH, Leydig cells, Sertoli cells, Spermiogenesis --- ---

NEET Set-Wise Unofficial Answer key

NEET Expected Rank Analysis 2024

NEET Expected Percentile Analysis 2024

Keep visiting CollegeDekho for the latest Education News on entrance exams, board exams and admissions. You can also write to us at our email ID news@collegedekho.com.

Are you feeling lost and unsure about what career path to take after completing 12th standard?

Say goodbye to confusion and hello to a bright future!

news_cta

NEET Previous Year Question Paper

icon

NEET 2024 Question Paper Code Q1

icon

NEET 2024 Question Paper Code R1

icon

NEET 2024 Question Paper Code S1

icon

NEET 2024 Question Paper Code T1

/news/neet-q3-unofficial-answer-key-2024-52589/

Do you have a question? Ask us.

  • Typical response between 24-48 hours

  • Get personalized response

  • Free of Cost

  • Access to community

Recent News

Subscribe to CollegeDekho News

By proceeding ahead you expressly agree to the CollegeDekho terms of use and privacy policy