NEET Q3 Unofficial Answer Key 2024 (Available)

Updated On: May 06, 2024 04:01 pm IST

Check the NEET Q3 Unofficial Answer Key 2024 PDF prepared with the help of subject matter experts. Candidates can cross-check their answers to calculate their raw score.

NEET Q3 Unofficial Answer Key 2024

NEET Q3 Unofficial Answer Key 2024: Candidates who appeared for the NEET 2024 exam on May 5 can check the key for Set Q3. The answers have been added for all the 200 questions asked in the exam. NEET Q3 answer key 2024 (unofficial) has been prepared by the subject matter experts. Candidates can expect the official answer key to be released by 12 - 15 days after the completion of the exam. Until then candidates can make use of the NEET Q3 answer key 2024 (unofficial) to determine the marks obtained in the exam.

Also Read |

Links \|
NEET Answer Key 2024 Unofficial (All Sets)	NEET Question Paper 2024	NEET 2024 Exam Analysis
NEET Expected Rank 2024	NEET Expected Percentile Score 2024	NEET Expected Cutoff Score 2024

Table of Contents |

NEET Q3 Unofficial Answer Key 2024 for Physics NEET Q3 Unofficial Answer Key 2024 for Chemistry NEET Q3 Unofficial Answer Key 2024 for Botany NEET Q3 Unofficial Answer Key 2024 for Zoology NEET Set-Wise Unofficial Answer key

NEET Q3 Unofficial Answer Key 2024 for Physics

Here is the unofficial NEET 2024 answer key for Set Code Q3 Physics subject:

Q3 Physics Section A

Question Number	Set Q3 Correct Answer	Question Number	Set Q3 Correct Answer
1	2	19	1- (10)
2	3- There will be a central dark fringe surrounded by a few colored fringes	20	2
3	3- B	21	1- 2µF
4	3- 8V	22	1- Strain and angle
5	4- 1240π ²	23	1- 4mm
6	2- 52Ω	24	1- AB and DC
7	3- 6N	25	4- 3.92ms ^-2
8	4- 4.4mT	26	2- A-III, B-IV, C-II, D-I
9	2- 2:1	27	4- The reflected light will be completely polarised but the refracted light will be partially polarised
10	4- Linear Graph	28	1- A-II, B-III, C-IV, D-I
11	2- Both I and II are correct statements	29	2- 2:1
12	2- 4T	30	4- 286, 81
13	3- Both A and B are correct	31	2- 5m, 2s
14	1- Zero	32	1- 19.8mN
15	4- Zero	33	4- AND gate
16	1- 8.5 cm	34	3- A is true but R is false
17	4- Varying velocity and varying acceleration	35	2- Point P moves faster than point Q
18	2- A, B, C and D only	---	---

Q3 Physics Section B

Question Number	Set Q3 Correct Answer	Question Number	Set Q3 Correct Answer
36	2- Displacement current of magnitude equal to I flows in the same direction as I	44	1 (5GmM/6R)
37	4- They originate from charges moving with uniform speed	45	2- A and C only
38	2- 28	46	2 - 0.93 A
39	2- 2:9	47	2- 50 × 10 ³ N
40	4- P1 > P2 > P3	48	2 (M/2)
41	3	49	2- A, C and E only
42	1	50	2
43	2- (√2)	---	---

Expected Cutoff |

Links \|
NEET General Category Expected Cutoff 2024	NEET EWS Category Expected Cutoff 2024
NEET OBC Category Expected Cutoff 2024	NEET SC Category Expected Cutoff 2024

NEET Q3 Unofficial Answer Key 2024 for Chemistry

Here is the unofficial NEET 2024 answer key for Set Code Q3 Chemistry subject:

Q3 Chemistry Section A

Question Number	Set Q3 Correct Answer	Question Number	Set Q3 Correct Answer
51	3- (A-III, B-IV, C-II, D-I)	69	3- A, C and D only
52	2- B>C>A	70	4
53	1- Both Statements I and II are correct	71	2 (A-III, B-IV, C-I, D-II)
54	1	72	1 (B and D only)
55	1- Both Statements I and II are correct	73	1 (4 mol of helium)
56	4	74	4 (Po)
57	4	75	3- d ⁴ to d ⁵ configuration
58	To be updated	76	3- B and E
59	2 (Li<B<Be<C< N)	77	2
60	4	78	1
61	4- Rate constant at two different temperatures	79	3- 2,3-dimethylbutane
62	1- Both Statements I and II are correct	80	1- aqueous copper sulphate
63	1 (Si<C<N<O<F)	81	4- (A-II, B-III, C-IV, D-I)
64	1 (A-II, B-IV, C-I, D-III)	82	1 (Both Statement I and Statement II are true)
65	1 (A-II, B-III, C-IV, D-I)	83	2- (Sublimation)
66	1 (A-I, B-IV, C-II, D-III)	84	3- A-IV, B-I, C-II, D-III
67	4	85	3- Reaction has a tendency to go in backward direction
68	1- (-x)	---	---

Q3 Chemistry Section B

Question Number	Set A3 Correct Answer	Question Number	Set A3 Correct Answer
86	1	94	1- 37°C
87	1- Both Statement I and Statement II are true	95	4- Three canonical forms can be drawn for CO ²₃⁻ ion
88	2- 0.315 g	96	1- propylamine
89	2	97	1- B, A, D, C, E
90	4- H ₃ PO ₃ and POCl ₃	98	2- (–413.14 calories)
91	1- 38.04 kJ/mol	99	4-- (0.717)
92	4- dilute sulphuric acid	100	2- ABC ₃
93	1	---	---

Upcoming Events of NEET 2024

Links
NEET OMR Response Sheet Expected Release Date 2024
NEET Result 2024 Release Date

NEET Q3 Unofficial Answer Key 2024 for Botany

Here is the unofficial NEET 2024 answer key for Set Code Q3 Botany subject:

Q3 Botany Section A

Question Number	Set Q3 Correct Answer	Question Number	Set Q3 Correct Answer
101	2- Phospholipids	119	2- Mode of Nutrition
102	4- 3 molecules of ATP and 2 molecules of NADPH	120	4 (a- Perigynous; b- Perigynous)
103	2- 6 bp	121	4- IUCN
104	1- C	122	3- B and C only
105	1- Zinc	123	3- A, C, D, and E only
106	1- Totipotency	124	3- Competitive inhibition
107	1 (A- III, B-II, C-IV, D-I)	125	3- Dedifferentiation
108	3- Statement I is true but statement II is false	126	2- Metaphase
109	1- Datura	127	1- A, C, D and E only
110	2- Biodiversity Conservation	128	1- Both Statement I and II are correct
111	4- B, C, D and E only	129	1- A-III, B-II, C-IV, D-I
112	3- Permease	130	1- Inward curling of leaves in monocots.
113	3- A-III, B-I, C-IV, D-II	131	2- Red flowered as well as pink flowered plants
114	3- Carrying Capacity	132	4- Promotor, Structural gene, Terminator
115	3- Does not affect mature monocotyledonous plants	133	2- bb
116	3- C	134	3- C, D and E only
117	4 - Statement I is false but Statement II is true	135	3- A-III, B-IV, C-I, D-II
118	4- A, B and D only	---	---

Q3 Botany Section B

Question Number	Set Q3 Correct Answer	Question Number	Set Q3 Correct Answer
136	Circular, double stranded	144	1- A-IV, B-I, C-II, D-III
137	2- A-III, B-I, C-IV, D-II	145	3- Succinyl-CoA → Succinic acid
138	1- A-II, B-IV, C-I, D-III	146	3- Statement I is true but Statement II is false
139	4- The DNA dependent DNA polymerase catalyses polymerization in 5’ → 3’ direction	147	1- A-IV, B-II, C-I, D-III
140	1- Wind pollinated plant inflorescence showing flowers with well exposed stamens	148	2- A-III, B-IV, C-I, D-II
141	2- A-I, B-II, C-III, D-IV	149	3-Protoplasts
142	3- A, C, D and E only	150	2- Gibberellin
143	3	---	---

NEET Q3 Unofficial Answer Key 2024 for Zoology

Here is the unofficial NEET 2024 answer key for Set Code A3 Zoology subject:

Q3 Zoology Section A

Question Number	Set Q3 Correct Answer	Question Number	Set Q3 Correct Answer
151	1- (E-C-A-D-B)	169	1- 5’AUGUACCGUUUAUAGGUAAGU3’
152	2- 10th Segment	170	2- (A-III, B-IV, C-II, D-I)
153	3- Convergent Evolution	171	3- (A-II, B-IV, C-I, D-III)
154	1- Uterine Fundus	172	4- Vaults
155	4 - (A-D-C-B)	173	2
156	4- Glucagon	174	3- Bio-reactors are used to produce small scale bacterial cultures
157	3 -(A-III, B-IV, C-I, D-II)	175	1- Both A and R are correct and R is the correct explanation of A
158	4 (E-C-A-D-B)	176	2- High pO ₂ and Lesser H ⁺ concentration
159	4- Constant gene pool	177	3- A-III, B-I, C-II, D-IV
160	2- A, B & E only	178	2- A only
161	2 (A-IV, B-III, C-I, D-II)	179	4- A-III, B-I, C-IV, D-II
162	1 (A-II, B-IV, C-I, D-III)	180	2- Both Statement I and Statement II are false
163	3- A-III, B-IV, C-I, D-II	181	2- The gene ‘X’ is responsible for controlling the copy number of the linked DNA and ‘Y’ for protein involved in the replication of Plasmid
164	4- A is false but R is false	182	4- A-II, B-I, C-IV, D-III
165	2- (A-II, B-I, C-IV, D-III)	183	2- A-III, B-I, C-II, D-IV
166	3- A-II, B-IV, C-I, D-III	184	4-A-III, B-I, C-IV, D-II
167	3- Tumor inducing plasmid	185	3- Statement I is true but Statement II is false
168	4- (A-III, B-IV, C-I, D-II)	---	---

Q3 Zoology Section B

Question Number	Correct Answer	Question Number	Correct Answer
186	4- Statement I is false but Statement II is true	194	4- A-III, B-I, C-IV, D-II
187	1- A-IV, B-II, C-III, D-I	195	3- A-III, B-IV, C-I, D-II
188	3- B, D & E only	196	4- A-IV, B-III, C-I, D-II
189	3- Loop of Henle of juxta medullary nephron runs deep into medulla	197	1- A only
190	3- Statement I is correct but Statement II is incorrect	198	2- A-III, B-II, C-IV, D-I
191	1- Both Statement I and Statement II are correct	199	3- Statement I is correct but Statement Il is incorrect
192	1- E, A, D, C, B	200	4- A-III, B-IV, C-I, D-II
193	1- FSH, Leydig cells, Sertoli cells, Spermiogenesis	---	---

NEET Set-Wise Unofficial Answer key

Set Code	Answer Key Link
Set Q1	NEET Q1 Unofficial Answer Key 2024
Set Q2	NEET Q2 Unofficial Answer Key 2024
Set Q4	NEET Q4 Unofficial Answer Key 2024
Set Q5	NEET Q5 Unofficial Answer Key 2024
Set Q6	NEET Q6 Unofficial Answer Key 2024

NEET Expected Rank Analysis 2024

Marks Range	Detailed Expected Rank Analysis
100 to 149	NEET 2024 Expected Rank for 100 to 149 Marks
150 to 199	NEET 2024 Expected Rank for 150 to 199 Marks
200 to 249	NEET 2024 Expected Rank for 200 to 249 Marks
250 to 299	NEET 2024 Expected Rank for 250 to 299 Marks
300	300 Marks in NEET 2024 means which rank?
310	310 Marks in NEET 2024 means which rank?
320	320 Marks in NEET 2024 means which rank?
660	660 Marks in NEET 2024 means which rank?
670	670 Marks in NEET 2024 means which rank?
680	680 Marks in NEET 2024 means which rank?
690	690 Marks in NEET 2024 means which rank?
700	NEET Rank 2024 for 700 Marks

NEET Expected Percentile Analysis 2024

Marks Range	Detailed Expected Percentile Analysis
150 to 199	Expected Percentile for 150 to 199 Marks in NEET 2024
200 to 249	Expected Percentile for 200 to 249 Marks in NEET 2024
250 to 299	Expected Percentile for 250 to 299 Marks in NEET 2024
300	Expected Percentile for 300 Marks in NEET 2024
310	Expected Percentile for 310 Marks in NEET 2024
320	Expected Percentile for 320 Marks in NEET 2024
660	Expected Percentile for 660 Marks in NEET 2024
670	Expected Percentile for 670 Marks in NEET 2024
680	Expected Percentile for 680 Marks in NEET 2024
690	Expected Percentile for 690 Marks in NEET 2024
700	Expected Percentile for 700 Marks in NEET 2024

Keep visiting CollegeDekho for the latest Education News on entrance exams, board exams and admissions. You can also write to us at our email ID news@collegedekho.com.