NEET Q4 Unofficial Answer Key 2024 (Available)

NEET Q4 Unofficial Answer Key 2024: The answers for all 200 questions solved by the subject experts for NEET Set Code Q4 question paper 2024 are provided here. Access the links from the table of contents to jump to the respective subject answer key.

Also Read |

Links |
NEET Answer Key 2024 Unofficial (All Sets)	NEET Question Paper 2024	NEET 2024 Exam Analysis
NEET Expected Rank 2024	NEET Expected Percentile Score 2024	NEET Expected Cutoff Score 2024

Table of Contents |

NEET Q4 Unofficial Answer Key 2024 for Botany NEET Q4 Unofficial Answer Key 2024 for Zoology NEET Q4 Unofficial Answer Key 2024 for Chemistry NEET Q4 Unofficial Answer Key 2024 for Physics NEET Set-Wise Unofficial Answer Key 2024

NEET Q4 Unofficial Answer Key 2024 for Botany

Here is the unofficial NEET 2024 answer key for Set Code Q4 Botany subject:

Q4 Botany Section A

Question Number	Set Q4 Correct Answer	Question Number	Set Q4 Correct Answer
101	(3) docs not affect mature monocotyledonous plants.	119	(2) bb
102	(4) 3 molecules of ATP and 2 molecules of NADPH	120	(1) A, C, D, and E only
103	(1) C	121	(4) A, B, and D only
104	(1) A-III, B-II, C-IV, D-I	122	(4) Promotor, Structural Gene, Terminator
105	(4) (a) Perigynous, (b) Perigynous	123	(2) 6 bp
106	(1) A-III, B-II, C-IV, D-I	124	(1) Zinc
107	(1) Datura	125	(3) A-III, B-I, C-IV, D-II
108	(4) B, C, D, and E only	126	(4) IUCN
109	(2) Red flowered as well as pink flowered plants	127	(2) Biodiversity conversion
110	(3) Dedifferentiation	128	(1) Totipotency
111	(3) A-III, B-IV, C-I, D-II (Out of syllabus question)	129	(3) Carrying Capacity
112	(3_ C, D, and E only	130	(1) Inward curling of leaves in monocots
113	(1) Both Statement I and Statement II are true	131	(2) Phospholipids
114	(2) Metaphase	132	(3) Competitive Inhibition
115	(3) B and C only	133	(3) Statement I is true but Statement II is false
116	(3) Permease	134	(3) C
117	(4) Statement I is false but Statement II is true	135	(2) A, C, D, and E only
118	(2) Mode of nutrition	---	---

Q4 Botany Section B

Question Number	Set Q4 Correct Answer	Question Number	Set Q4 Correct Answer
136	(2) A-II, B-I, C-IV, D-III	144	(2) A-III, B-IV, C-I, D-II
137	(2) A-III, B-I, C-IV, D-II	145	(1) Wind-pollinated plant inflorescence showing flowers with well-exposed stamens
138	(2) x (kcalm -2 ) yr -1	146	(2) Circlular, double stranded
139	(3) A, C, D, and E only	147	(3) Statement I is true but Statement II is false
140	(2) Gibberellin	148	(1) A-IV, B-I, C-II, D-III
141	(1) A-IV, B-II, C-I, D-III	149	(1) A-II, B-IV, C-I, D-III
142	(4) The DNA-dependent DNA polymerase catalyses polymerization in 5'→3' direction.	150	(3) Protoplasts
143	(3) Succinyl-CoA → Succinic acid	---	---

Expected Cutoff |

Links |
NEET General Category Expected Cutoff 2024	NEET EWS Category Expected Cutoff 2024
NEET OBC Category Expected Cutoff 2024	NEET SC Category Expected Cutoff 2024

NEET Q4 Unofficial Answer Key 2024 for Zoology

Here is the unofficial NEET 2024 answer key for Set Code Q4 Zoology subject:

Q4 Zoology Section A

Question Number	Set Q4 Correct Answer	Question Number	Set Q4 Correct Answer
151	(2) A-II, B-I, C-IV, D-III	169	(3) A, B, and E only
152	(4) E-C-A-D-B	170	(2) A-III, B-I, C-II, D-IV
153	(3) A-III, B-I, C-III, D-I	171	(4) A is false but R is true
154	(2) A-IV, B-III, C-I, D-II	172	(2) A-II, B-IV, C-I, D-III
155	(3) Convergent Evolution	173	(4) A-II, B-I, C-IV, D-III
156	(1) E-C-A-D-B	174	(3) A-II, B-IV, C-I, D-III
157	(2) Bio-reactors are used to produce small scale bacterial cultures	175	(2) A only
158	(1) Uterine Fundus	176	(3) A-III, B-IV, C-I, D-III
159	(1) Both Statement I and Statement II are false	177	(4) A-III, B-I, C-IV, D-II
160	(4) Constant gene pool	178	(2) (a) Skeletal - Triceps (b) Smooth - Stomach (c) Cardiac - Heart
161	(4) Glucagon	179	(3) A-III, B-IV, C-I, D-II
162	(4) A-III, B-I, C-IV, D-II	180	(2) High pO2 and lesser H+ concentration
163	(2) 10th segment	181	(4) A-D-C-B
164	(1) A-II, B-IV, C-I, D-III	182	(4) A-III, B-IV, C-I, D-II
165	(2) A-III, B-IV, C-II, D-I	183	(1) Both A and R are true and R is the correct explanation of A
166	(3) Statement I is true but Statement II is false	184	(4) Valuts
167	(2) The gene 'X' is responsible for controlling the copy number of the linked DNA and 'Y' for protein involved in the replication of Plasmid.	185	(3) Tumor inducing plasmid
168	(2)  5' AUGUACCGUUUAUAGGUAAGU	---	---

Q4 Zoology Section B

Question Number	Correct Answer	Question Number	Correct Answer
186	(4) A-III, B-IV, C-I, D-II	194	(4) A-III, B-I, C-IV, D-II
187	(3) Statement I is true but Statement II is false	195	(1) A only
188	(1) E-A-D-C-B	196	(4) Statement I is false but Statement II is true
189	(1) A-IV, B-II, C-III, D-I	197	(1) Both Statement I and Statement II are true
190	(2) B, D, and E only	198	(3) A-III, B-IV, C-I, D-II
191	(3) Loop of Henle of juxta medullary nephron runs deep into medula	199	(4) A-IV, B-III, C-I, D-II
192	(3) Statement I is true but Statement II is false	200	(1) FSH, Leydig cells, Sertoli cells, spermiogencsis
193	(2) A-III, B-II, C-IV, D-I	---	---

Upcoming Events of NEET 2024

Links
NEET OMR Response Sheet Expected Release Date 2024
NEET Result 2024 Release Date

NEET Q4 Unofficial Answer Key 2024 for Chemistry

Here is the unofficial NEET 2024 answer key for Set Code Q4 Chemistry subject:

Q4 Chemistry Section A

Question Number	Set Q4 Correct Answer	Question Number	Set Q4 Correct Answer
51	(4) Po	69	(3) B and E
52	(3) A-III, B-IV, C-II, D-I	70	(4) A, C and D
53	(1) Aqueous copper sulphate	71	(3) A-IV, B-I, C-II, D-III
54	(1) A-II, B-IV, C-I, D-III	72	(1) Both Statement I and Statement II are true
55	(2) (i) BH 3 (ii) H 2 O 2 / OH - (iii) PCC	73	(3) Reaction has a tendency to go in backward direction.
56	(1)	74	(2) A-III, B-IV, C-I, D-II
57	(4) rate constant at two different temperatures	75	(3) 2,3-dimethylbutane
58	(1) A-II, B-III, C-IV, D-I	76	(2) Sublimation
59	(@) 250 mg	77	(4)
60	(1) Si < C < N < O < F	78	(1) Both Statement I and Statement II are true
61	(4) A-II, B-III, C-IV, D-I	79	(4) BaCl 2 + Na 2 SO 4 → BaSO 4 + 2NaCl
62	(4)	80	(1) A-I, B-IV, C-II, D-III
63	(1) - x	81	(2) Li < B < Be < C < N
64	(4)	82	(1) B and D only
65	(2) B > C > A	83	(3) d 4 to d 5 configuration
66	(4)	84	(1) 4 mol of helium
67	(1)	85	(1) Both Statement I and Statement II are true
68	(1) Both Statement I and Statement II are true	---	---

Q4 Chemistry Section B

Question Number	Set Q4 Correct Answer	Question Number	Set Q4 Correct Answer
86	(1) Ce 4+ ad Yb 2+	94	(4) Dilute sulphuric acid
87	(1) B, A, D, C, E	95	(4) Three canonical forms can be drawn for CO 3 2- ion.
88	(1)	96	(1) 38.04 kJ/mol
89	(4) 413.4 calories	97	(2)
90	(1) propylamine	98	(2) 310°C
91	(4) H 3 PO 3 and POCl 3	99	(1) Both Statement I and Statement II are true
92	(2) 0.315 g	100	(4) 0.717
93	(2) ABC 3	---	---

NEET Q4 Unofficial Answer Key 2024 for Physics

Here is the unofficial NEET 2024 answer key for Set Code Q4 Physics subject:

Q4 Physics Section A

Question Number	Set Q4 Correct Answer	Question Number	Set Q4 Correct Answer
1	(4) zero	19	(1) strain and angle
2	(3) OR gate	20	(3) both the reflected and refracted light will be completely polarized
3	(3) there will be a central bright white fringe surrounded by a few coloured fringes	21	(3) A is true but R is false.
4	(2) 1 / 100(N + 1)	22	(2) Point P moves faster than point Q.
5	(1) 4 mm	23	(2) 5 m, 2s
6	(1) 8.5 cm	24	(3) B bar
7	(3) 4.4 mT	25	(2) A, B, C, and D only
8	(1) 10	26	(2) 4T
9	(2) 2:1	27	(3) 8 V
10	(3) 6 N	28	(4) 1280 π 2
11	(4) 3.92 m s -2	29	(2) 52 ohm
12	(1) A is correct but B is incorrect	30	(1) A-II, B-III, C-4, D-1
13	(2) √5/2	31	(4) 286, 81
14	(1) Both Statement I and Statement II are true	32	(4)
15	(1) 19.8 mN	33	(2) 2:1
16	(1) AB and DC	34	(1) zero
17	(4) Varying velocity and varying acceleration	35	(1) 2 µF
18	(2) A-III, B-IV, C-II, D-I	---	---

Q4 Physics Section B

Question Number	Set Q4 Correct Answer	Question Number	Set Q4 Correct Answer
36	(2) A, C, and E only	44	(3)
37	(2) 0.93 A	45	(2) 28
38	(2) αt/β	46	(1) 5GmM/6R
39	(4) P 1 > P 2 > P 3	47	(2) √2
40	(2) M/2	48	(3) A, C, and D only
41	(2) displacement current of magnitude equal to I flows in the same direction as I.	49	(2) 2 : 9
42	(2) 50 x 10 3 N	50	(4) they originate from charges moving with uniform speed.
43	(4)	---	---

NEET Set-Wise Unofficial Answer Key 2024

Set Code	Answer Key Link
Set Q1	NEET Q1 Unofficial Answer Key 2024
Set Q2	NEET Q2 Unofficial Answer Key 2024
Set Q3	NEET Q3 Unofficial Answer Key 2024
Set Q5	NEET Q5 Unofficial Answer Key 2024
Set Q6	NEET Q6 Unofficial Answer Key 2024

NEET Expected Rank Analysis 2024

Marks Range	Detailed Expected Rank Analysis
100 to 149	NEET 2024 Expected Rank for 100 to 149 Marks
150 to 199	NEET 2024 Expected Rank for 150 to 199 Marks
200 to 249	NEET 2024 Expected Rank for 200 to 249 Marks
250 to 299	NEET 2024 Expected Rank for 250 to 299 Marks
300	300 Marks in NEET 2024 means which rank?
310	310 Marks in NEET 2024 means which rank?
320	320 Marks in NEET 2024 means which rank?
660	660 Marks in NEET 2024 means which rank?
670	670 Marks in NEET 2024 means which rank?
680	680 Marks in NEET 2024 means which rank?
690	690 Marks in NEET 2024 means which rank?
700	NEET Rank 2024 for 700 Marks

NEET Expected Percentile Analysis 2024

Marks Range	Detailed Expected Percentile Analysis
150 to 199	Expected Percentile for 150 to 199 Marks in NEET 2024
200 to 249	Expected Percentile for 200 to 249 Marks in NEET 2024
250 to 299	Expected Percentile for 250 to 299 Marks in NEET 2024
300	Expected Percentile for 300 Marks in NEET 2024
310	Expected Percentile for 310 Marks in NEET 2024
320	Expected Percentile for 320 Marks in NEET 2024
660	Expected Percentile for 660 Marks in NEET 2024
670	Expected Percentile for 670 Marks in NEET 2024
680	Expected Percentile for 680 Marks in NEET 2024
690	Expected Percentile for 690 Marks in NEET 2024
700	Expected Percentile for 700 Marks in NEET 2024