NEET R3 Unofficial Answer Key 2024 (Available)

Supreeta Roy

Updated On: May 06, 2024 04:09 pm IST

Appeared for NEET Set Code R3 paper? Download NEET R3 Unofficial Answer Key 2024 in PDF format here to evaluate your performance in the test.
NEET R3 Unofficial Answer Key 2024 (Image Credit: Pexels)NEET R3 Unofficial Answer Key 2024 (Image Credit: Pexels)

NEET R3 Unofficial Answer Key 2024 : The National Testing Agency (NTA) conducted the NEET exam today, May 5, 2024. Since the examination has concluded, candidates who have appeared for the exam can check out the answers for all 200 questions here. The NEET R3 Answer key 2024 (unofficial) has been prepared with the help of subject matter experts. The key for all the subjects has been added below. Candidates can click the link in the 'Table of Contents' to get directed to the subject-wise answer key.

Also Read |

Links |
NEET Answer Key 2024 Unofficial (All Sets) NEET Question Paper 2024 NEET 2024 Exam Analysis
NEET Expected Rank 2024 NEET Expected Percentile Score 2024 NEET Expected Cutoff Score 2024

Table of Contents |

NEET R3 Unofficial Answer Key 2024 for Zoology

Here is the unofficial NEET 2024 answer key for Set Code R3 Zoology subject:

R3 Zoology Section A

Question Number Set R3 Correct Answer Question Number Set R3 Correct Answer
151 (3) 169 (3)
152 (2) 170 (3)
153 (2) 171 (2)
154 (1) 172 (1)
155 (2) 173 (3)
156 (3) 174 (4)
157 (1) 175 (1) A only
158 (1) 176 (3) A-IV, B-II, C-I, D-II
159 (3) 177 (2) A-IV, B-I, C-II, D-III
160 (2) 178 (1) A-III, B-IV, C-II, D-I
161 (3) 179 (3) Gene 'X' is responsible for recognition sites and 'Y' is responsible for antibiotic resistance.
162 (3) 180 (3) Statement I is false but Statement II is true
163 (1) 181
(4) Both A and R are correct, and R is the correct explanation of A
164 (3) 182 (4) E-C-A-D-B
165 (4) 183 (2) 5'AUGUAAAGUUUAUAGGUAAGU3
166 (1) 184 (1) A-III, B-1, C-II, D-IV
167 (2) 185 (2) Tumor inducing plasmid
168 (2) --- ---

R3 Zoology Section B

Question Number Correct Answer Question Number Correct Answer
186 (1) A-III, B-II, C-IV, D-I 194 (4) E, A, D, C, and B
187 (4) Both Statements I and II are true. 195 (2) B, D, and E only
188 (4) Both Statement 1 and Statement Il are correct. 196 (4) A-IV, B-II, C-III, D-I
189 2) Loop of Henle of juxta medullary nephron runs deep into medulla 197 (2) Statement 1 is correct but Statement II is incorrect
190 (3) A-III, B-IV, C-I, and D-II 198 (4) A-II, B-I, C-III, D-IV
191 (2) A-III, B-IV, C-I, and D-II 199 (4) A only
192 (3) A-IV, B-III, C-I, and D-II 200 (4) Both Statement I and Statement II are correct
193 (4) FSH, Leydick cells, Sertoli cells, spermiogenesis --- ---

Expected Cutoff |

Links |
NEET General Category Expected Cutoff 2024 NEET EWS Category Expected Cutoff 2024
NEET OBC Category Expected Cutoff 2024 NEET SC Category Expected Cutoff 2024

NEET R3 Unofficial Answer Key 2024 for Chemistry

Here is the unofficial NEET 2024 answer key for Set Code R3 Chemistry subject:

R3 Chemistry Section A

Q A Q A
51 (3) 69 (1)
52 (2) 70 (2)
53 (4) 71 (4)
54 (4) 72 (4)
55 (3) 73 (2)
56 (2) 74 (4)
57 (4) 75 (3)
58 (2) 76 (2)
59 (4) 77 (4)
60 (3) 78 (3)
61 (3) 79 (3)
62 (1) 80 (1)
63 (1) 81 (1)
64 (2) 82 (4)
65 (4) 83 (3)
66 (4) 84 (3)
67 (3) 85 (1)
68 (1) --- ---

R3 Chemistry Section B

Question Number Set R3 Correct Answer Question Number Set R3 Correct Answer
86 (3) 94 (2) E, C, D, B, A
87 (1) 95 (1) -413.14 calories
88 (3) 96 (2)
89 (4) 97 (1) 380.4 kJ/mol
90 (2) butanamide 98 (3) dilute sulphuric acid
91 (1) Ce 3+ and Eu 2- 99 (4) 37°C
92 (4) 100 (4) Three resonance structures can be drawn for ozone.
93 (4) ABC 3 --- ---

Upcoming Events of NEET 2024

Links
NEET OMR Response Sheet Expected Release Date 2024
NEET Result 2024 Release Date

NEET R3 Unofficial Answer Key 2024 for Physics

The unofficial NEET 2024 answer key for Set Code R3 Physics subject has been provided here:

R3 Physics Section A

Question Number Set R3 Correct Answer Question Number Set R3 Correct Answer
1 (4) 19 (2) 1:1
2 (2) 20 (2) 1.98 mN
3 (3) 21 (4) 4 mm
4 (4) 22 (3) 3.92 ms -2
5 (4) 23 (3) 10 (N + 1)
6 (3) 24 (4) Both Statements I and II are correct
7 (3) 25 (2) 6 N
8 (3) 26 (4) Strain and Angle
9 (2) 27 (4) 8.5 cm
10 (4) 28 (4) A is correct but B is incorrect
11 (1) 29 (3) 60 ohms
12 (2) 30 (1) 5 m, 2s
13 (2) 31 (4) A and B only
14 (3) 32 (1) A-III, B-IV, C-II, D-1
15 (3) 33 (2) 2
16 (1) 34 (4) 5
17 (1) Point P moves faster than Point A 35 (1) 4T
18 (4) Zero --- ---

R3 Physics Section B

Question Number Set R3 Correct Answer Question Number Set R3 Correct Answer
36 (3) 2 * 10 3 N 44 (2) A, C, and D only
37 (4) 45 (2)
38 (1) 28 46 (1) Displacement current of magnitude equal to I flows in the same direction as I.
39 (3) 47 (1)
40 (1) 0.93 A 48 (1)
41 (1) 2:9 49 (3)
42 (2) 50 (4)
43 (3) they originate with charges moving with uniform speed. --- ---

NEET R3 Unofficial Answer Key 2024 for Botany

The following table displays NEET 2024 answer key for Set Code R3 Botany subject:

R3 Botany Section A

Question Number Set R3 Correct Answer Question Number Set R3 Correct Answer
101 (3) Promotor, Structural Gene, Terminator 119 (4)
102 (1) A, B, C, and D only 120 (2)
103 (1) Phospholipids 121 (4) In situ conservation
104 (3) A, B, and D only 122 (2) A-III, B-IV, C-I, D-II
105 (2) 123 (2) Dedifferentiation
106 (4) 124 (2) Anaphase
107 (2) 125 (1) bb
108 (3) 126 (1) Red-flowered as well as pink-flowered plants
109 (3) 127 (2) Competitive Inhibition
110 (2) 128 (4) Both Statement I and Statement II are true
111 (4) 129 (4) C
112 (1) 130 (1) A, C, D, and E only
113 (4) 131 (3) D
114 (4) 132 (4) Promotes apical dominance
115 (3) 133 (4) Both Statement I and Statement II are true
116 (4) 134 (4) Totipotency
117 (2) 135 (3) Statement I is false but Statement II is true
118 (1) --- ---

R3 Botany Section B

Question Number Set R3 Correct Answer Question Number Set R3 Correct Answer
136 (1) Gibberellin 144 (2) 10x (kcal m²) yr-1
137 (4) Both Statement I and Statement II are true 145 (2) A-IV, B-III, C-II, D-I
138 (1) A-IV, B-I, C-II, D-III 146 (2) A-I, B-II, C-IV, D-III
139 (2) A, C, D, and E only 147 (2)
140 (3) The DNA dependent DNA polymerase catalyses polymerization in 5'→3' direction. 148 (1)
141 (4) Malic acid → Oxaloacetic acid 149 (1)
142 (3) A-III, B-IV, C-II, D-I 150 (1)
143 (4) Wind pollinated plant inflorescence showing flowers with well exposed stamens. --- ---

NEET Set-Wise Answer Key 2024

Set Code Answer Key Link
Set R1 NEET R1 Unofficial Answer Key 2024
Set R2 NEET R2 Unofficial Answer Key 2024
Set R4 NEET R4 Unofficial Answer Key 2024
Set R5 NEET R5 Unofficial Answer Key 2024
Set R6 NEET R6 Unofficial Answer Key 2024

NEET Expected Rank Analysis 2024

Marks Range Detailed Expected Rank Analysis
100 to 149 NEET 2024 Expected Rank for 100 to 149 Marks
150 to 199 NEET 2024 Expected Rank for 150 to 199 Marks
200 to 249 NEET 2024 Expected Rank for 200 to 249 Marks
250 to 299 NEET 2024 Expected Rank for 250 to 299 Marks
300 300 Marks in NEET 2024 means which rank?
310 310 Marks in NEET 2024 means which rank?
320 320 Marks in NEET 2024 means which rank?
660 660 Marks in NEET 2024 means which rank?
670 670 Marks in NEET 2024 means which rank?
680 680 Marks in NEET 2024 means which rank?
690 690 Marks in NEET 2024 means which rank?
700 NEET Rank 2024 for 700 Marks

NEET Expected Percentile Analysis 2024

Marks Range Detailed Expected Percentile Analysis
150 to 199 Expected Percentile for 150 to 199 Marks in NEET 2024
200 to 249 Expected Percentile for 200 to 249 Marks in NEET 2024
250 to 299 Expected Percentile for 250 to 299 Marks in NEET 2024
300 Expected Percentile for 300 Marks in NEET 2024
310 Expected Percentile for 310 Marks in NEET 2024
320 Expected Percentile for 320 Marks in NEET 2024
660 Expected Percentile for 660 Marks in NEET 2024
670 Expected Percentile for 670 Marks in NEET 2024
680 Expected Percentile for 680 Marks in NEET 2024
690 Expected Percentile for 690 Marks in NEET 2024
700 Expected Percentile for 700 Marks in NEET 2024

Keep visiting CollegeDekho for the latest Education News on entrance exams, board exams and admissions. You can also write to us at our email ID news@collegedekho.com.

Are you feeling lost and unsure about what career path to take after completing 12th standard?

Say goodbye to confusion and hello to a bright future!

news_cta

NEET Previous Year Question Paper

NEET 2016 Question paper

/news/neet-r3-unofficial-answer-key-2024-available-52546/

Do you have a question? Ask us.

  • Typical response between 24-48 hours

  • Get personalized response

  • Free of Cost

  • Access to community

Subscribe to CollegeDekho News

By proceeding ahead you expressly agree to the CollegeDekho terms of use and privacy policy
Top
Planning to take admission in 2024? Connect with our college expert NOW!