NEET T3 Unofficial Answer Key 2024 (Available)

Updated On: May 06, 2024 04:39 PM

Appeared for Set Code T3 paper? Download here NEET T3 Unofficial Answer Key 2024 in PDF format and cross-check your answers to calculate your raw score.

NEET T3 Unofficial Answer Key 2024

NEET T3 Unofficial Answer Key 2024: The answer key for NEET Set Code T3 2024, covering all 200 questions, is now available and is being updated one by one on this page. Test takers can use the table of contents to quickly access the answer key for Physics, Chemistry, Botany, and Zoology subjects.

Also Read |

Links \|
NEET Answer Key 2024 Unofficial (All Sets)	NEET Question Paper 2024	NEET 2024 Exam Analysis
NEET Expected Rank 2024	NEET Expected Percentile Score 2024	NEET Expected Cutoff Score 2024

Table of Contents |

NEET T3 Unofficial Answer Key 2024 for Botany NEET T3 Unofficial Answer Key 2024 for Zoology NEET T3 Unofficial Answer Key 2024 for Chemistry NEET T3 Unofficial Answer Key 2024 for Physics NEET Set-Wise Unofficial Answer Key 2024

NEET T3 Unofficial Answer Key 2024 for Botany

Here is the unofficial NEET 2024 answer key for Set Code T3 Botany subject:

T3 Botany Section A

Question Number	Set T3 Correct Answer	Question Number	Set T3 Correct Answer
101	(2) B, C, D and E only	119	(4) Red flowered as well as pink flowered plants
102	(4) Biodiversity Conservation	120	(1) A-III B-IV C-I D-II
103	(1) Competitive Inhibition	121	To be updated
104	(2) D	122	1) A-III B-I C-IV D-II
105	(3) Inward curling of leaves in monocots	123	(3) C
106	(1) C, D and E only	124	(3) Datura
107	(1) Dedifferentiation	125	(2) Promoter, Structural gene, Terminator
108	To be updated	126	(1) B and C only
109	(3) A, C, D and E only	127	(1) does not affect mature monocotyledonous plants
110	(4) Mode of Nutrition	128	(3) Zinc
111	(2) 3 molecules of ATP and 2 molecules of NADPH	129	(10) Permease
112	(2) A, B and D only	130	(4) A, C, D, and E only
113	(3) Totopotency	131	(1) Statement I is true but Statement II is false
114	(1) Carrying capacity	132	(2) Statement I is false, But Statement II is true
115	(4) Metaphase	133	(3) Both Statement I and Statement II are true
116	(2) a-Perigynous, b- Perigynous	134	(3) A-III B-II C-IV D-I
117	(4) bb	135	(2) iUCN
118	To be updated	---	---

T3 Botany Section B

Question Number	Set T3 Correct Answer	Question Number	Set T3 Correct Answer
136	(4) Circular double stranded	144	(4) A-II B-I C-IV D-III
137	(1) Protoplasts	145	(2) The DNA Dependent DNA polymerase catalysts polymerization in '5'-3' direction
138	(3) Wind-pollinated plant inflorescence showing flowers with well exposed stamens	146	(4)
139	(4) Gibberellin	147	(3) A-II B-IV C-I D-III
140	(4) A-III B-IV C-I D-II	148	(4) A-IIIB-I C-IV- D-II
141	To be updated	149	To be updated
142	(1) Statement I is true but Statement II is false	150	(1) A, C, D and E only
143	(1) Succinyl-CoA- Succinic acid	---	---

Expected Cutoff |

Links \|
NEET General Category Expected Cutoff 2024	NEET EWS Category Expected Cutoff 2024
NEET OBC Category Expected Cutoff 2024	NEET SC Category Expected Cutoff 2024

NEET T3 Unofficial Answer Key 2024 for Zoology

Here is the unofficial NEET 2024 answer key for Set Code T3 Zoology subject:

T3 Zoology Section A

Question Number	Set T3 Correct Answer	Question Number	Set T3 Correct Answer
151	To be updated	169	(4) Both A and R are true but R is NOT the correct explanation of A.
152	(2) A-III B-I C-IV D-II	170	(4) The gene 'X' is responsible for controlling the copy number of the linked DNA and 'Y' for protein involved in the replication of Plasmid.
153	(1) Statement I is true but Statement II is fase	171	(1) A-II, B-I, C-III, D-IV (2) A-III, B-IV, C-I, D-II
154	(4) A-IV, B-III, C-I, D-II	172	(4) A only
155	(4) A-III, B-IV, C-II, D-I	173	(2) Statement I is false but Statement II is true
156	(2) Glucagon	174	(2) A-III, B-1, C-IV, D-II
157	(3) 5' AUGUACCGUUAUAGGUAAGU3'	175	(2) Vaults
158	(4) (a) Skeletal- Triceps (b) Smooth – Stomach (c) Cardiac- Heart	176	(4) A-II, B-1, C-IV, D-III
159	(2) E-C-A-D-B	177	(2) A-II B-I C-IV D-III
160	(4) A, B and E only	178	(1) Bio-reactors are used to produce small scale bacterial cultures.
161	(1) A-II, B-IV, C-1, D-III	179	(1) A-II B-IV C-1 D-III
162	(1) Convergent evolution	180	(1) A-III, B-I, C-II, D-IV
163	(3) A-II, B-IV, C-I, D-III	181	(3) Both A and R are correct and R is the correct explanation of A
164	2 Constant gene pool	182	(4) A-III, B-I, C-II, D-IV
165	(2) A-D-C-B	183	(1) Tumor inducing plasmid.
166	(3) E-C-A-D-B	184	(2) Ampulla
167	(4) High pO2 and Lesser H+ concentration	185	(1) A-III, B-IV, C-I, D-II
168	(1) A-III, B-IV, C-L, D-II	---	---

T3 Zoology Section B

Question Number	Correct Answer	Question Number	Correct Answer
186	(1) A-III B-IV C-I D-II	194	(3) A-IV, B-II, C-III, D-I
187	(2) A-III, B-I, C-IV, D-II	195	(1) Loop of Henle of adjacent medullary nephron runs deep into medulla.
188	(1) Statement I is correct but Statement II is incorrect.	196	(4) A-III, B-II, C-IV, D-I
189	(3) FSH, Leydig cells, Sertoli cells, spermiogenesis	197	(3) A only
190	(2) A-IV B-III C-I D-II	198	(2) Statement I is false but Statement II is true
191	(2) A-III, B-IV, C-I, D-II	199	(3) E, A, D, C, B
192	(1) A-III, B-IV, C-I, D-II	200	(1) Statement I is correct but Statement II is incorrect
193	(1) Statement I is correct but Statement II is incorrect.	---	---

Upcoming Events of NEET 2024

Links
NEET OMR Response Sheet Expected Release Date 2024
NEET Result 2024 Release Date

NEET T3 Unofficial Answer Key 2024 for Chemistry

Here is the unofficial NEET 2024 answer key for Set Code T3 Chemistry subject:

T3 Chemistry Section A

Question Number	Set T3 Correct Answer	Question Number	Set T3 Correct Answer
51	(3) A-II, B-IV, C-I, D-III	69	(1) B and E
52	(2) BaCl2 + Na2SO4  BaSO4 + 2NaCl	70	(1) A – III ; B – IV ; C – II ; D – I
53	(3)	71	(2) PO
54	(3) aqueous copper sulphate	72	(1) Reaction has a tendency to go in backward direction.
55	(4) 250 mg	73	2
56	(3) A-I, B-IV, C-II, D-III	74	3
57	(3) d5 to d4 configuration	75	3
58	(2) A-II, B-III, C-IV, D-I	76	2
59	(2) rate constant at two different temperature.	77	3
60	(1) 2,3-dimethylbutane	78	1
61	(3) B and D only	79	4
62	(3) Si < C < N < O < F	80	(3) A-II, B-III, C-IV, D-I
63	(2)	81	(3) Both Statement I and Statement II are true.
64	(3) Both statement I and Statement II are true.	82	(4) Li < B < Be < C < N
65	(3) Both statement I and Statement II are true.	83	3
66	(4) A – III, B – IV, C – I, D – II	84	2
67	(1)	85	4
68	(4) (i) BH3, (ii) H2O2/OH, (iii) PCC	---	---

T3 Chemistry Section B

Question Number	Set T3 Correct Answer	Question Number	Set T3 Correct Answer
86	4	94	3
87	3	95	3
88	4	96	(2) 0.717
89	4	97	(4) –413.14 calories
90	3	98	(4) 0.315 g
91	2	99	3
92	2	100	3
93	3	---	---

NEET T3 Unofficial Answer Key 2024 for Physics

Here is the unofficial NEET 2024 answer key for Set Code T3 Physics subject:

T3 Physics Section A

Question Number	Set T3 Correct Answer	Question Number	Set T3 Correct Answer
1	(1) 4.4 mT	19	4
2	To be updated	20	4
3	(3) zero	21	2
4	(1) both the reflected and refracted light will be completely polarised	22	2
5	(3) 1: 2	23	2
6	(1) overline B	24	2
7	(3) 1/10N	25	3
8	3	26	4
9	1	27	2
10	(1) there will be a central bright white fringe surrounded by a few coloured fringes	28	3
11	2	29	2
12	(3) 2uF	30	4
13	3	31	4
14	3	32	3
15	4	33	2
16	1	34	4
17	3	35	4
18	1	---	---

T3 Physics Section B

Question Number	Set T3 Correct Answer	Question Number	Set T3 Correct Answer
36	2	44	4
37	4	45	4
38	2	46	4
39	3	47	1
40	4	48	4
41	4	49	3
42	4	50	1
43	4	---	---

NEET Set-Wise Unofficial Answer Key 2024

Set Code	Answer Key Link
Set T1	NEET T1 Unofficial Answer Key 2024
Set T2	NEET T2 Unofficial Answer Key 2024
Set T4	NEET T4 Unofficial Answer Key 2024
Set T5	NEET T5 Unofficial Answer Key 2024
Set T6	NEET T6 Unofficial Answer Key 2024

NEET Expected Rank Analysis 2024

Marks Range	Detailed Expected Rank Analysis
100 to 149	NEET 2024 Expected Rank for 100 to 149 Marks
150 to 199	NEET 2024 Expected Rank for 150 to 199 Marks
200 to 249	NEET 2024 Expected Rank for 200 to 249 Marks
250 to 299	NEET 2024 Expected Rank for 250 to 299 Marks
300	300 Marks in NEET 2024 means which rank?
310	310 Marks in NEET 2024 means which rank?
320	320 Marks in NEET 2024 means which rank?
660	660 Marks in NEET 2024 means which rank?
670	670 Marks in NEET 2024 means which rank?
680	680 Marks in NEET 2024 means which rank?
690	690 Marks in NEET 2024 means which rank?
700	NEET Rank 2024 for 700 Marks

NEET Expected Percentile Analysis 2024

Marks Range	Detailed Expected Percentile Analysis
150 to 199	Expected Percentile for 150 to 199 Marks in NEET 2024
200 to 249	Expected Percentile for 200 to 249 Marks in NEET 2024
250 to 299	Expected Percentile for 250 to 299 Marks in NEET 2024
300	Expected Percentile for 300 Marks in NEET 2024
310	Expected Percentile for 310 Marks in NEET 2024
320	Expected Percentile for 320 Marks in NEET 2024
660	Expected Percentile for 660 Marks in NEET 2024
670	Expected Percentile for 670 Marks in NEET 2024
680	Expected Percentile for 680 Marks in NEET 2024
690	Expected Percentile for 690 Marks in NEET 2024
700	Expected Percentile for 700 Marks in NEET 2024

Keep visiting CollegeDekho for the latest Education News on entrance exams, board exams and admissions. You can also write to us at our email ID news@collegedekho.com.